kassalinaa kassalinaa
  • 02-10-2018
  • English
contestada

The belief that ones culture is superior to another.
A. Prejudice
B. Stereotype
C. Ethnocentrism
D. Racism

Respuesta :

Gabe7890 Gabe7890
  • 02-10-2018
I think it might be B if not sorry
Answer Link
AmyCollette
AmyCollette AmyCollette
  • 02-10-2018

B I'm pretty sure (:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the value of x?
What man made object is likely to endure long after humans have disappeared from new york city?
When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?
In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?
The sum of two numbers is 69. The larger number is three less than twice the smaller number. Find the numbers. Show your work.
How did the triple alliance and the triple entente change during the war?
Concerns over the Spanish treatment of what nation help lead to the Spanish–American War? A. Hawaii B. Portugal C. Canada D. Cuba
NEED HELP ASAPPPPPPP
What is the solution of the system of equations? y = –2x + 8 y = x – 4