countrygirl22803 countrygirl22803

03-10-2018
Chemistry

contestada

list 3 elements that were named for famous scientists

Respuesta :

JJValenta JJValenta

03-10-2018

Curium (Marie and Pierre Curie)
•Einsteinium (Albert Einstein)
Rutherfordium (Ernest Rutherford)

Answer Link

Otras preguntas

Which form of the compensation would be the greatest? a) A salary of 3,000.00 Monthly b) wages of 20.00 per hr. Receiving Commission of 20%.

electron configuration for potassium

What group began to dominate the south

What fraction of numbers between 0 and 0.25 will round down when rounded to 1 decimal place? Give your fraction in its simplest form. It was 3/5 I need explana

a car is moving with a velocity of 25m/s for 15s. calculate the displacement of the car. The acceleration of the car over the 15s

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

what is a computer please tell me

One line passes through the point (-2,1) and (4,9). another lines passes through points (-3,8) and (5,2). are theses lines parallel,perpendicular,or neither

A car travels 3 miles in 4 minutes. At this rate, how many miles does the car travel in one hour?

Can someone tell me the answer to this please????