idontknow11223344 idontknow11223344
  • 04-02-2019
  • English
contestada

Please help me further explain

How does social media influence teenagers behavior? In a couple of sentences...

Respuesta :

KrishnaBalaram1235
KrishnaBalaram1235 KrishnaBalaram1235
  • 04-02-2019

Media influence on teenagers can be deliberate – for example, advertising is often directed at children and teenagers. This means that children and teenagers are increasingly conscious of brands and images. You’re not alone if your child has pestered you to buy the next ‘in’ thing!


Answer Link

Otras preguntas

Use the Internet to research current events on healthcare reform. How will proposed healthcare reform impact insurance practices in the pharmacy?
Mi abuelo no es joven. Es _____
Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta
CAN SOMEONE HELP ME WITH THIS PLEASE ??
Do you think there are benefits to teaching prisoners about philosophy?
How did the triple alliance and the triple entente change during the war?
what is the relationship between hitech and hipaa
What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!
Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat