thebesthhah thebesthhah
  • 04-03-2019
  • History
contestada

Pls help I will mark brainliest

Pls help I will mark brainliest class=

Respuesta :

Patrick50000897 Patrick50000897
  • 06-03-2019

B: Translated the Quran into the most forien language.

Answer Link

Otras preguntas

what's the percentage of 1/8 ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you write fifty-seven thousand,eighteen. In standard form
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
How do I do trebuchet calculations????? Help me please
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters