surfergirlmymy surfergirlmymy
  • 02-04-2019
  • Mathematics
contestada

Abdul's gas tank is 1/5 full. After he buys 7 gallons of gas, it is 7/10 full. How many gallons can Abdul's tank hold?

Respuesta :

carlosego
carlosego carlosego
  • 02-04-2019

Answer: 14 gallons

Step-by-step explanation:

Let's call the total gallons Abdul's tank can hold x.

Then, based on the information given in the problem, you can write the following expression:

[tex]\frac{1}{5}x+7=\frac{7}{10}x[/tex]

Therefore, when you solve for x, you obtain the following result:

[tex]\frac{1}{5}x+7=\frac{7}{10}x\\\\\frac{1}{5}x-\frac{7}{10}x=-7\\\\-\frac{1}{2}x=-7\\\\-x=(-7)(2)\\x=14[/tex]

Answer Link

Otras preguntas

The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.
Which correctly describes the reaction between potassium and excess water?
Find 8 + 35 + (-76).
Which option would best fit in this diagram in the bubble labeled 1?
Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by
What is the value of x?
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
need help anybody know how to do this