joshuap65 joshuap65
  • 03-03-2020
  • Mathematics
contestada

What is an equation of the line that passes through the points (-2,1) and (-6,-5)

Respuesta :

philaeagles14
philaeagles14 philaeagles14
  • 03-03-2020

Answer: y = 3/2x+4 if you need to write it in slope intercept form and please give brainliest i will appreciate it.

Answer Link

Otras preguntas

What is 299.9875 to the nearest hundredth
what was a characteristic of the Roman senate?
A manufacturer of acrylic, latex, and nitrile gloves sells to medical laboratories, factories where employees handle chemicals, companies that manufacture micro
You toss two fair coins together how many different outcomes will you get?
investigation, determine when the Elastic Potential Energy is zero. Make sure you test your idea with several masses, all three springs and vary the stiffness o
A rectangle has a height of 7 and a width of 2x^2 – 3. Express the area of the entire rectangle. Expression should be expanded. 2x^2 -3 7 Area -
Ina solution prepared by dissolving .100 mole of pro panic acid in enough water to make 1L of solution, the ph is observed to be 2.924. The Ka for propanoic aci
Can some one help me with linear systems I have like three topics in that category and I’m having a lot of trouble I would greatly appreciate it if you would li
0.5 kg is equal to how many ounces?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA