nathan1783 nathan1783
  • 04-09-2020
  • Mathematics
contestada

Simplify. 2x (3-1) + 3​

Respuesta :

lillywiller1997 lillywiller1997
  • 04-09-2020

Answer:

4x+3

2x (3-1) + 3​

2x(2)+3

4x+3

Answer Link

Otras preguntas

If a man with a mass of 80 kg stops at the bottom of a building and wants to climb to the top. If the height of the building is 9 meters above the ground, calcu
HELP!!!! Given the inequality 6x - 10y ≥ 9 select all possible solutions!! ( -1, 1) ( 2, 8) ( 2, 1) (-3, -4) ( 5, 2) ( 4, -2)
solve this system of equations by graphing . first graph the equations then type the solution . y=1/5x-5 y=-3/5x-1 PLEASE HELP ILL GIVE 40 POINTA PLEASE DONT SK
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Phil wants to enlarge a photo that is 6 inches wide and 8 inches tall. The enlarged photo keeps the same ratio. How tall is he enlarged photo if it is 12 inches
PLEASE ANSWER HURRY!!
1 Fine the lines) that shows that Macbeth is beginning to become mental unstable
What assumptions do we make about others? Please respond in a paragraph.
Age-related vision changes. astigmatism b hyperopia c myopia d presbyopia (Principles of Health Science - eye and ear exam)
Solid aluminum metal reacts with chlorine gas to produce aluminum chloride crystals. How many grams of aluminum chloride will be produced if the reaction begins