cjenkins2541 cjenkins2541
  • 01-10-2020
  • Mathematics
contestada

what is the slope of the line that contains the points (-5,6) and 14,-7)?

A. -13/5
B. 7/5
C. -13/19
D. 7/19

Respuesta :

funnymonster2 funnymonster2
  • 01-10-2020
the answer is c

because ive had this question
Answer Link

Otras preguntas

an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Compliant is to stubborn as excited is to
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
4(3-5)=-2(8-z)-6z what is z
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Please help me with this two step math problem! THANK YOU !!!!!!!!
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites