amorrosi14 amorrosi14
  • 02-12-2020
  • Mathematics
contestada

Need answers immediately, thank you in advance!

Need answers immediately thank you in advance class=

Respuesta :

madhumita10
madhumita10 madhumita10
  • 02-12-2020

Step-by-step explanation:

this is the answer...............

Ver imagen madhumita10
Ver imagen madhumita10
Answer Link

Otras preguntas

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Please help solve, thanks in advance!
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is 0.00001267 is scientific notation
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
how do you know 8 thousandths is less than 1 hundredths
How much money, in dollars, does one mole of nickels represent?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage