samaraparisaca19 samaraparisaca19

03-12-2020
Mathematics

contestada

find the vertex of the following quadratic function
f (x) = -3x² + 7x + 11
a. (0.857 , 4.384)
b. (1.166 , 15.083)
c. (-2.45 , 3.18)
d. (1 , 12)

Respuesta :

03-12-2020

Answer:

B because it's a fraction I just divided them and got b

Answer Link

slasher91 slasher91

03-12-2020

b is the answer I believe

Answer Link

Otras preguntas

Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.

Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?

what is x? using the picture below and directions

Paula begins to notice there are patterns to where people sit on the bus, and that these patterns differ depending on whether the rider is male or female. based

At age 76 years, which chronic condition is elizabeth most likely to have?

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

How do you find x ????