alaskamango20
alaskamango20 alaskamango20
  • 03-12-2020
  • Mathematics
contestada

POGGGGGGGGGGGGGGGGGGGGG

Respuesta :

CaptSteamer
CaptSteamer CaptSteamer
  • 03-12-2020

Answer:

hi

Step-by-step explanation:

how's your day going#pogggg

Answer Link
pftpft23 pftpft23
  • 04-12-2020
Lollllllll howwwww rrr uuuu
Answer Link

Otras preguntas

The test scores for a group of students are shown. 89, 74, 100, 86, 74, 67, 86, 72, 60, 93, 83, 86 What is the median of the scores?
Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?
How are logos, pathos, and ethos I used in an argument
Name a few important body functions that your nervous system controls on its own without you having to think about it much?
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the solution to the equation ? n = −1 n = 2 n = 5/3 n = 5/2
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession
Which of the following can be a cause of social change?