ecervantes0573 ecervantes0573

04-02-2021
Chemistry

contestada

How many moles are in 6.93 x 1023 sulfur dioxide molecules?

Respuesta :

ihlester ihlester

10-02-2021

Answer: 1.15 moles

Explanation:

1 mole = 6.02214076*10^23 molecules

Answer Link

Otras preguntas

which function has the solution set shown in the graph?

Who can become an American citizen through the process of naturalization?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

The cube root of the square root of the real number in is 16. what is the value of n.

What is mitochondria

If the measures of two opposite angles of a parallelogram are represented by 3x+40 and x+50 what is the measure of each angle of the parallelogram

Find the measure of an exterior angle of each regular polygon: 100-gon.