royaltips
royaltips royaltips
  • 03-11-2016
  • English
contestada

The reader can infer that mallam sile is not well respected in the village because he

Respuesta :

Аноним Аноним
  • 03-11-2016
maybe because of the way the text is written in the book.... like lets say that Timmy told his friend he doesn't like his shirt and said it like this "i hate that shirt your wearing" that would give off a bad vibe and make the reader and the other character feel bad, and if he said it like this "hey i don't really like the shirt your wearing today" it wouldn't be necessary for him to say that but that would give off a good vibe that wouldn't hurt the other characters feelings. I hope that helped you! 
Answer Link

Otras preguntas

How has water influenced the development of civilization in Africa
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
how do you know 8 thousandths is less than 1 hundredths
How do you write fifty-seven thousand,eighteen. In standard form
How do you put allele in a sentence
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The section of the small intestine between the duodenum and ilium?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?