notclumzyie290 notclumzyie290

01-04-2021
English

contestada

The words what and is can be contracted to

Respuesta :

Аноним Аноним

01-04-2021

Answer:

They can be contracted to what's

Answer Link

Otras preguntas

How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?

What does the word "Islam" mean?

if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer

The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Attorney general a. mitchell palmer believed that he needed to protect the american people from

What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define

World population is approximately upper p equals 6.4 left-parenthesis 1.0126 right-parenthesis superscript t, with upper p in billions and t in years since 2004

Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)