wissehmarius23 wissehmarius23

01-04-2021
History

contestada

match the main general with the side in the civil war

Respuesta :

kat3311 kat3311

07-04-2021

Answer:

Confederacy: General Robert E. Lee

Union: Ulysses S. Grant

Explanation:

Answer Link

Otras preguntas

The incline of a roller coaster is 2 times as long as its elevation, and the horizontal length of the roller coaster is 11 m more than the elevation. what is th

With increasing doses of any useful drug there is usually an increase in the number and severity of

NEED HELP PLEASE!!!!!!! The answers for the first arrow is 32, 33.6, 34, 35.4 The second arrow answers are $93.60, $94.20, $96.40, $97.80

Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _

why is the inner mitochondrial membrane folded

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

The term used when an organism is studied in its natural environment is

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which type of bone has the least amount of spongy bone relative to its total volume?

What is the First Language On world?