jello559 jello559
  • 04-05-2021
  • Mathematics
contestada

Solve for x to the nearest tenth

Solve for x to the nearest tenth class=

Respuesta :

cshayan269
cshayan269 cshayan269
  • 04-05-2021
i think its x equals 4
Answer Link
isabellakoster
isabellakoster isabellakoster
  • 04-05-2021
x=√24 = 4,8 approximately
Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what are the 2 major types of cofactors?
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Where did middle names come from
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor