Seudónimo Seudónimo
  • 01-12-2016
  • Mathematics
contestada

In art class mrsJocelyn gave everyone a 1 foot stick to measure and cut Vivian measured and cut her stick into 5 equal pieces Scott measured and cut his into 7 equal pieces Scott said to Vivian the total length of my stick is longer than yours because I have 7 pieces and you only have 5

Respuesta :

Аноним Аноним
  • 01-12-2016
idk sorry i cant help

hope this helps XD
Answer Link

Otras preguntas

Tu as quels cours le jeudi matin?
Do you think then solid can undergo convection
4(3-5)=-2(8-z)-6z what is z
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve the equation -10 + 3x + 5x = -56 ? ??
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
Explain who or what "Año Viejo" is and its significance.
Why were the committees of correspondence powerful?