maryvaultman1176 maryvaultman1176
  • 02-11-2021
  • Social Studies
contestada

why did workers begin to organize into labor unions in the mid-1800s?

Respuesta :

27jbaird
27jbaird 27jbaird
  • 02-11-2021

Answer:

Their problems were low wages and unsafe working conditions.

Explanation:

In the late 1800s, workers organized unions to solve their problems.  ... First, workers formed local unions and later formed national unions. These unions used strikes to try to force employers to increase wages or make working conditions safer.

Answer Link

Otras preguntas

this has me so confused on how you get the answers
When did Christianity become the official religion for the Roman Empire
this is a class called foundation seminar music and math
The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.
I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
what is x? using the picture below and directions
The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
Explain the carbon cycle and explain why burning fossil fuels is an issue.
Both Ghandhi and king set which type of mood in their introduction