Meowweeee Meowweeee
  • 03-01-2017
  • Mathematics
contestada

4r + 9r- 11r +7r
Simfly the expressions by combing like terms??

Respuesta :

Аноним Аноним
  • 03-01-2017
9r because 4+9 is 13+7 is 20-11 is 9
Answer Link
AL2006
AL2006 AL2006
  • 03-01-2017
Solve this one in exactly the same way as I solved the one
that you posted 1 minute before this one.

--  add up all the ' r 's .

--  add up all of the just-plain-numbers

This time, the answer looks like  9r .

You should spend a few minutes with it so that
you know where this answer comes from.  
Answer Link

Otras preguntas

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Tu as quels cours le jeudi matin?
What is the range of function of y-1=(x+3)^2
the reproductive system of a male mammal provides
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
The Panama Canal connects what two bodies of water?
a antonym for biosphere