ad4iebraxlbrit ad4iebraxlbrit

04-01-2017
Biology

contestada

A region that includes several interacting ecosystems is called ___

Respuesta :

yop1010 yop1010

04-01-2017

Answer: Landscape

Hope this helps :)

Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

Make w the subject of Y-aw=2w-1

What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp

Sancho Panza is the farmer who acts as Quixote's 1._______. When Quixote attacks a 2.______ in the passage, Panza him 3_______. the choices for these are 1.co

what does the liver do in the excretory system

Insulin is a protein that is used by the body to regulate both carbohydrate and fat metabolism. a bottle contains 425 ml of insulin at a concentration of 20.0 m

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Choose all that apply. Melinda finds that she does not like taking risks with her money. Which of the following would you recommend for her? Collectibles stock