emmafowlkes
emmafowlkes emmafowlkes
  • 03-02-2022
  • Social Studies
contestada

What are the 4 causes of atmospheric changes? Please help asap!

Respuesta :

mikaenahthaxter
mikaenahthaxter mikaenahthaxter
  • 03-02-2022

Answer:

Earth's temperature is a balancing act.

The greenhouse effect causes the atmosphere to retain heat.

Changes in the sun's energy affect how much energy reaches Earth's system.

Changes in reflectivity affect how much energy enters Earth's system.

Answer Link

Otras preguntas

I need help with this problem!
PLEASE HELP ASAP simplify (3x^2 - 3 + 9x^3) - (4x^3 - 2x^2 + 16).x^3 - 5x^2 + 25-x^3 + x^2 + 255x^3 + 2x + 13 5x^3 + 5x^2 - 19
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
People and societies in which they live lie outside the biosphere.
help pls :) I am stuck on this chemistry question about percentage yields!
Suppose n is odd. find the cube of n and divide it by 4. what possible remainders could occur? check all the possible ones and none of the impossible ones.
I need the answer and the path work ok
For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile
How is the creation of public policy in Russia different from that in the United States?
What is the distance between points (21, -32) and (-3, -25)?