YadelinF178164 YadelinF178164
  • 03-11-2022
  • Mathematics
contestada

Hello, I need some assistance with this homework question please for precalculusHW 23

Hello I need some assistance with this homework question please for precalculusHW 23 class=

Respuesta :

MathiusQ414683 MathiusQ414683
  • 03-11-2022

ANSWER

slope = 1

EXPLANATION

Given:

Points (1, 2) and (8, 9).

Desired Outcome:

Slope of the line

Applying the slope formula

[tex]slope\text{ = }\frac{y_2\text{ - y}_1}{x_2\text{ - x}_1}[/tex]

where:

y2 = 9,

y1 = 2

x2 = 8 and

x1 = 1

Substituting the values

[tex]\begin{gathered} slope\text{ = }\frac{9\text{ - 2}}{8\text{ - 1}} \\ slope\text{ = }\frac{7}{7} \\ slope\text{ = 1} \end{gathered}[/tex]

Hence, the slope of the line containing the points (1, 2) and (8, 9) is 1.

Answer Link

Otras preguntas

Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates
Which absorption rate of minerals is faster plant foods or animal foods?
Many worship services include a speech given by a church leader. this speech is called a
One of the benefits that the gi bill of rights offered to returning veterans was
Who basically "began" England's religious reformation?
What did Chinese traders exchange with Islamic merchants?
What are some examples of dramatic irony in The Hobbit?
why are the hindlimbs important on the frog
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.