kaygirlnelson4982 kaygirlnelson4982
  • 02-10-2017
  • Social Studies
contestada

"repealing the affordable care act now would open a real can of worms" is a poorly phrased central idea for a persuasive speech because it

Respuesta :

ahmedishaal ahmedishaal
  • 11-10-2017
It is poorly phrased central idea for a persuasive speech because it contains figurative language.
The persuasion needs facts which can be describes using literal language as opposed to figurative language which is often used in poetry though sometimes in prose also but it contains an explanation which is different from the literal interpretation. 
Answer Link

Otras preguntas

does mercury have a magnetic field
Find the missing length indicated
the expression 3.25b + 2h gives the cost of b burgers and h hot dogs what is the cost of 4 burgers and 6 hot dogs
Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.
When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False
Find 8 + 35 + (-76).
a sample of dna contains 20 percent adenine and 30 percent cytosine. What percentage of tymine would you expect to find.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!
Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x