haydooley haydooley

02-11-2017
Mathematics

contestada

Four pounds of apples cost $1.56. What is the unit cost?

Respuesta :

Becca7828 Becca7828

02-11-2017

The answer is $6.24 Hope this helps :)

Answer Link

Otras preguntas

why might beavers be a good example for humans on how to be behave?

Question 17 (5 points) The Open Door Policy was created by France as a way to open trade in Indochina. True False

Find the slope of the given line on the graph. REMEMBER: Rise over run! Pls show work!

You have worked as a guide at the aquarium for two summers. This summer you have been offered the job again, but with a 4 percent raise. Last summer you worked

Two objects moving in opposite directions with the same speed v undergo a totally inelastic collision, and half the initial kinetic energy is lost. Find the rat

"The sum of twice a number and 10 is 36"

Unstable export markets, worsening terms of trade, and limited access to the markets in advanced countries are just a few of the problems that have plagued nati

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

An electron is accelerated through a potential difference of 2.8 kV and directed into a region between two parallel plates separated by 17 mm with a potential d

Which of these would not lead you to suspect that a burned building was the result of arson? A) The suspect was in debt. B) The suspect was a heavy smoker. C)