miafarfan miafarfan
  • 02-12-2017
  • Biology
contestada

How does the patellar reflex protect us?

Respuesta :

meerkat18
meerkat18 meerkat18
  • 12-12-2017

Reflexes in general allow us to react much more quickly because the signal only has to go to the spinal cord and back, rather than going to the brain for processing and back. That makes it possible to make quick adjustments for coordination purposes.

Answer Link

Otras preguntas

A generator stores electric current. Explain why you agree or disagree with this statement
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Give a recursive algorithm for finding the sum of the first n odd positive integers.
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the sum of 6/10 plus 7/12
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?