e4esra e4esra
  • 03-01-2016
  • English
contestada

slogan on exercise for children

Respuesta :

Аноним Аноним
  • 03-01-2016
Play right, eat right, live right
Answer Link

Otras preguntas

how do you know 8 thousandths is less than 1 hundredths
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
What is the sum of 6/10 plus 7/12
where are the three parts of an atom located
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 points on the graph for 6x-5y=25