shukriibrahim36
shukriibrahim36 shukriibrahim36
  • 03-12-2020
  • Biology
contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa
  • 03-12-2020
I don’t feel like answering all that but....
C=G G=C T=A A=U
Answer Link
vicgraisi1220
vicgraisi1220 vicgraisi1220
  • 03-12-2020
C=G A=T dont know the rest have a gcodocododd dday
Answer Link

Otras preguntas

The ratio of Sam age to Hanks is 5 to 3. If the sum of their ages is 24, how old is Hank?
Bethany's dog eats 450 grams of food per day. How many kilograms does the dog eat in a week
What are preventable injuries and unpreventable injuries
What's the answer to this problem?
three snack bars contain 1/5,0.22,and 19% of their calories from fat. which snack bar contains the least amount of calories from fat ?
Why does 2 pi divided by 1/3 equal 6 pi?
How far away is Canopus in kilometres?
what other areas did the french explorers find
I forgot what are homophones.Does anyone know what's a homophone.
The tickets for the concert are selling for $12.00. Juanita is going to the concert with a group of 25 people. There is a discount of 1/8 off each ticket for gr