shukriibrahim36
shukriibrahim36 shukriibrahim36
  • 03-12-2020
  • Biology
contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa
  • 03-12-2020
I don’t feel like answering all that but....
C=G G=C T=A A=U
Answer Link
vicgraisi1220
vicgraisi1220 vicgraisi1220
  • 03-12-2020
C=G A=T dont know the rest have a gcodocododd dday
Answer Link

Otras preguntas

What is mightier than steel yet cowers from the sun?
If x = -3, what is the value of (1 - x)^3? Explain why
What capacitor in series with a 100 ω resistor and a 21 mh inductor will give a resonance frequency of 1010 hz ?
What are the requirements for combustion of a candle?
Can someone help me please?? A B C D
Which of the following is a solution to the system of linear equations below 2x=-3y. 2y=6x-22. A (2,5). B(-2,5). C(2,-5). D (-2,-5)
Viruses are different from bacteria in that
Evaluate the function rule for the given rule. f(x)=5^x for x=2
The function f(x) = x3 is translated such that the function describing the translated graph is g(x) = (x + 5)3 + 2.Where is the point (0, 0) for the function f
I need help answering this question!