pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

The first person to recognize and name an australopithecine was:___________.
Triangle R is a right triangle. Can we use two copies of Triangle R to compose a parallelogram that is not a square? Explain your reasoning. R. R.
14) ¿Cuántos cubos de 1 cm por lado caben dentro de otro cubo que mide por lado 2cm?
What would be the best positive control when testing for proteins
Egypt, what kind of leadership does such a civilization need? What does a government need to do to protect the way of life for its people? Can you think of any
Calculate the millimoles of solute in 1.88 L of a 0.00713 M NaCN solution. millimoles:
Which is NOT a synthetic (manmade) fiber? A. Spandex B. Nylon C. Silk D. Polyester
Il _____espagnol. êtes est sont sommes
Which statement best explains what Paine says about the king?
How did Rome influence the development of democracy in the Western world?