pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

6. What makes an electromagnet stronger than a solenoid? 7. Identify the four ways you can increase the strength of an electromagnet. 1. 2. 3. 4.
what's is the constant proportionality in the equation y=5x?
food travels from the stomach to the?
Can somebody help me with the exercise 2 pls? Thankk uuu
Which was a Sumerian religious practice?
Several studies have found that in the United States ,their is a rising trend of obesity for people between the ages of 2 and 19. What does this say about the c
7. Vivica sees that a printer costs $679 and a computer costs $1,358. What is the total cost of the printer and the computer?​
Why is it important for us to learn about history
Diffusion is what type of Transport -Active Transport -Cell Transport -Passive Transport -Atom Transport
Match Term Definition He is the best cook in town, and I love to have dinner at their place! A) Mature Writing Because he has unrivaled skills in the kitchen, t