CONFESSIONS9413 CONFESSIONS9413
  • 02-06-2018
  • History
contestada

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

Respuesta :

yourfaceisnotba
yourfaceisnotba yourfaceisnotba
  • 03-06-2018
The answer is: Temperance, and racism (IF theres options, tell me ) 
Answer Link

Otras preguntas

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly
Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2
Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis
how did white supremacists provide support for the ku klux klan
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How many neutrons does element X have if its atomic number is 31 and its mass number is 90?
Application of force with movement is called _______________ exercise.
The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.
What two molecules are produced by the light reactions and used to power the calvin cycle?
A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie