xavier4376 xavier4376
  • 04-09-2018
  • Mathematics
contestada

Julie wrote the rate 108$ in 6 weeks as a unit rate.Find her mistake and correct it.

Respuesta :

ralphwx1 ralphwx1
  • 04-09-2018

Unit rate has 1 in the denominator. $108 in 6 weeks has 6 weeks as the denominator, which isn't one of anything (unless we treat 6 weeks to be a unit). What Julie probably intended as the unit rate was $108/6 weeks = $18 / week.

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the primary purpose of the Supremacy Clause?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
How do you write fifty-seven thousand,eighteen. In standard form
Why did the American public mostly oppose joining the League of Nations after WWI?
What is the sum of 6/10 plus 7/12
4.2meters= how many centimeter
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress