Seudónimo Seudónimo
  • 04-04-2016
  • Mathematics
contestada

How do you get the answer for 10 millimeters increased by 30%

Respuesta :

SmarticalParticals
SmarticalParticals SmarticalParticals
  • 04-04-2016
First you have to find what 30% of ten is, and then add it to the 10. So how do you find 30 % of 10? In math...

"of" means ×
"is" means =

30% of 10 is
30 % × 10 =

change 30% to a decimal by dividing by 100 ( move the decimal to the left 2 places)

.30 × 10 = 3

So 30% of ten is 3. Now since we are increasing by 30%, we have to add it to the original value, 10.

3 + 10 = 13

So 10 millimeters increased by 30% is

13 millimeters
Answer Link

Otras preguntas

how do i find the angles on a kite?
What kind of problems did increased urbanization cause? During time of industrial revolution
3+1/4x greater than 11
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
round 7,782 to the nearest hundred
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
define concentric circles
A vehicle is only 15% efficient. What happened to the other 85%?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5