marcobarila marcobarila
  • 03-04-2019
  • Biology
contestada

explain what a plant produces in each of the 2 parts of its life cycle

Respuesta :

203793 203793
  • 03-04-2019

All plants alternate between 2 phases in their life cycles. Plant life cycles alternate between producing SPORES and GAMETES. Plants produce GAMETES but their reproductive cycle includes a few extra steps. ... A mature SPOROPHYTE has specialized cells that divide by MEIOSIS to produce HAPLOID SPORES.

Answer Link

Otras preguntas

Do you think then solid can undergo convection
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
What is the additive inverse of -4a
Please answer theses division problems!! 9 divided by 3/7
Why did the American public mostly oppose joining the League of Nations after WWI?
What are the factors of 6x + 24?
2ln(5x)=8 solve for x