munchkin0918 munchkin0918

03-12-2019
Health

contestada

The medical term meaning excision of the thyroid gland

Respuesta :

lharris382 lharris382

03-12-2019

Answer:

Thyroidectomy

Explanation:

Answer Link

Otras preguntas

Text-Dependent Questions Directions: For the following questions, choose the best answer or respond in complete sentences 1. PART A What does the word "stalwart

Help me with this please!!!

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Bracken, Louden, and Menser, who share profits and losses in a ratio of 4:2:2, respectively are partners in a home decorating business that has not been able to

Consider the Telnet example discussed in Slide 78 in Chapter 3. A few seconds after the user types the letter ‘C’, the user types the letter ‘R’. After typing t

1. How much energy would be required to melt 450 grams of ice at 0°C? 2. How many joules of energy would be release as 325 grams of steam condenses to liquid wa

A new cellular phone tower services all phones within a 17 mile radius. Doreen lives 15 miles and and 8 miles south of the tower. Is she within the area service

what is the volume of 3.00 mole of ideal gas at 100.0 C and 2.00 kPa

What did participants in the March on Washington demand? O Passage of the civil rights bill O Integration of schools by the end of the year An end to job discri

A. If the bank provides an annual percentage yield of 3.2%, what will be the balance when lucy turns 1? turns 2? turns 3?