stevenmartinez2008 stevenmartinez2008

01-01-2020
Mathematics

contestada

Alia works for 18.3 hours and earns $585.60. What does Alia earn per hour?

Respuesta :

mindyyyy mindyyyy

01-01-2020

Alia earns $32 per hour. Check photo for work and please mark me as brainliest :)

Ver imagen mindyyyy

Answer Link

Otras preguntas

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen

Differences between body composition- risk for heart disease or chronic disease.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates

The root word graph means to _____. speak, write, read

why is the inner mitochondrial membrane folded

describe how the resistance of the filament lamp changes as the current through it increases.

when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions