loveeesavite
loveeesavite loveeesavite
  • 02-07-2016
  • History
contestada

who led the raid on harpers ferry in 1859

Respuesta :

jolinda23
jolinda23 jolinda23
  • 02-07-2016
John Browns I believe.
Answer Link

Otras preguntas

One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from
Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron
Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron
Explain the carbon cycle and explain why burning fossil fuels is an issue.
Since Ramon has 8 liter jug of water and since he fills nine 750 millimeter pitchers with water how much water is left??
Read the following excerpt from Sandra Cisneros’s story "Mericans." “Por favor,” says the lady. “¿Un foto?” pointing to her camera. “Si.” She’s so busy taking
IS THIS A COMMON KNOWLEDGE OR NEEDS CITATION .In December of 2003, Joan Didion lost her husband of forty years, John Gregory Dunne, after a massive heart attack
FIRST ONE TO ANSWER CORRECT GETS BRAINLYIST! Which characteristics of Dickinson’s style are evident in "The Snow”? Check all that apply. - four-line stanzas -
what was considered an act of war in 1914?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat