danielleteamer danielleteamer

03-03-2020
Spanish

contestada

La carnicería está _______________del mercado. (behind)

Respuesta :

ammp2004 ammp2004

03-03-2020

Answer: atras

Explanation:

Answer Link

alondra990 alondra990

03-03-2020

La carnicería está atrás del mercado.

Answer Link

Otras preguntas

On a frictionless surface, a 32 kg student pushes a 43 kg student. If the 32 kg student slides back at 2.4 m/s, how fast will the 43 kg student be sliding and i

A school pays $1,825 for 150 shirts. This includes the $25 flat-rate shipping cost. What equation models the total cost as a function of the number of T-shirts

Cooper and his children went into a bakery and where they sell cupcakes for $2.50 each and donuts for $1.50 each. Cooper has $40 to spend and must buy a minimum

Assume that y varies inversely with x. If y= 16 when x = 0.5, find y when x = 32. y=[ ? ]

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Identify the parts of this sentence. The umbilical cord links the baby to its mama.

Are you more likely to see a tsunami forming in the deep ocean or near the coast?

A calorimeter contains 0.50 kg of water at 15°C. A 0.040-kg block of zinc at 115°C is placed in the water. The specific heat of zinc is 388 J/kg °C and the spec

Carroll Corporation has two products, Q and P. During June, the company's net operating income was $25,000, and the common fixed expenses were $54,000. The cont

I went to visit my friend and ____ her baby very carefully because she was a tiny baby. hold helded holded held