avaconte20 avaconte20
  • 01-05-2020
  • Mathematics
contestada

how many edges does a 3D pentagon have

Respuesta :

dkh111557
dkh111557 dkh111557
  • 01-05-2020

Answer:

A 3D pentagon has 15 edges.

Answer Link

Otras preguntas

What’s the slope to this graph?
Use the Distributive Property to simplify the expression. 1(8+x+4) = 0
In a bag of blue and yellow candies, the ratio of blue candies to yellow candies is 3:5. If the bag contains 60 yellow candies, how many blue candies are there?
what is dangerous about living for seven days on just one can of sardines?
What four programs were included in Johnson's Great Society
Explain briefly why social workers should take appropriate personal safety training and practice safety measures.
In the figure below, points S, T, and U are the midpoints of the sides of PQR. suppose TU =24, PQ =36, and QR =60. find the following lengths. find S​
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Help I will be marking brainliest!!! A. 36√3 B. 36 C. 24 D. 24√3 Show work, if possible. Thanks❤️
A string can withstand a force of 135 N before breaking. A 2.0 kg mass is tied to the string and whirled in a horizontal circle with a radius of 1.10 m. What is