jasonalvarez1012
jasonalvarez1012 jasonalvarez1012
  • 02-10-2020
  • Mathematics
contestada

The graph below shows the solution to which system of inequalities?

The graph below shows the solution to which system of inequalities class=

Respuesta :

179
179 179
  • 02-10-2020

Answer:

D

Step-by-step explanation:

Answer Link

Otras preguntas

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how many moles of NaCl are equivalent to 15.6g NaCl
What did president wilson's wife make sure was on the white house lawn?
The length of a rectangular garden is 4 m greater than the width. the area of the garden is nbsp 60m squared . find the dimensions of the garden.
People and societies in which they live lie outside the biosphere.
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
I=$310 P==$1,000 t=5 years
The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?
A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?