imranafshan97 imranafshan97
  • 03-11-2020
  • Medicine
contestada

what keeps the particles in a solid in this arrangement
​

Respuesta :

jaydenpeek7
jaydenpeek7 jaydenpeek7
  • 03-11-2020

Answer:

The particles of a solid are connected by strong forces, which pull the particles together. Although the particles can vibrate, they cannot move around easily. This arrangement explains why solids usually keep their shape.

Explanation:

Have a great day love!

Answer Link

Otras preguntas

It takes 10 workers 24 hours to do a job. Fill in the chart.
What is the distance between points (21, -32) and (-3, -25)?
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho
Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now
which item below is part of the circulatory system a. kidneysb. lungsc. heart or d. stomach
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
who invented the theory of relativity
During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.
Find f(x) if it is known that f(x−2)=2x−4.