vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

What was the purpose of the Open Door Policy?
how would you classify the relationship between the age of people on the number of books they read
The circulatory system is an organ system that is composed of __________. cells, organs, and organisms cells, tissue, and organisms tissue, organs, and organism
Cold packs are designed to become very cold when activated. When the pack is activated, a chemical reaction occurs to make the temperature of the cold pack decr
Please help with the 4th one
What is 7 3/7- 2 8/21
What other property of the object increases as well?
When you round 6 5/11 what's the nearest whole number
re-write these notices in the passive form: 1. you must not touch the computer. 2. you must write this in capital letters. 3. you are not to use this lift witho
Ava is 23 cm taller than olivia, and olivia is half the height of Lucas. if Lucas is 1.78 m tall, how tall are Ava and olivia? express their heights in centimet