serenityhavens serenityhavens
  • 03-12-2020
  • English
contestada

In " What of this Goldfish Would you wish" what archetype is Sergei?

Respuesta :

abbywitbeck60
abbywitbeck60 abbywitbeck60
  • 03-12-2020

Answer:

The short story “What, of this goldfish, Would You Wish? ' is an emotive short story written by Etgar Keret. In this story he uses Archetype of the innocent youth being Yonatan an ambitious young documenter, he has a bombastic idea for a documentary which he decides to solely execute by himself.

Explanation:

hope this helps in any way :)

Answer Link

Otras preguntas

What role does the House of Representative have in the impeachment process?
help pls :) I am stuck on this chemistry question about percentage yields!
How many 1900 galveston hurricane facts homes and buildings was destroyed?
31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
what is the absolute value of the complex number -4 — √2i
Would someone please help me with my french? Thank you! Fill in the blank after reading the options and looking at the pictures. I will type out the options her
You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome
Please help me out with this
Which option would best fit in this diagram in the bubble labeled 1?