zaa9765 zaa9765
  • 04-01-2021
  • Mathematics
contestada

What is the difference between percent difference and percent change?

Respuesta :

vgriffin0304 vgriffin0304
  • 05-01-2021

Answer:

Percent change is comparing one current number or value to another.

Percent difference is comparing a number or value to another number or value.

Step-by-step explanation:

Answer Link

Otras preguntas

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
the perimeter of a square 116ft ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
The section of the small intestine between the duodenum and ilium?