Avaanidalal Avaanidalal

01-03-2021
Mathematics

contestada

what fraction is next in pattern 1/8, 1/4, 3/8, 1/2 ?

Respuesta :

lupinst0r lupinst0r

01-03-2021

Answer: 5/8

Step-by-step explanation:

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

what type of reaction is sodium reacting with chlorine

On circle O above the measure of arc SV is 120 degrees. What is the measure of arc VU.

Evaluate the following. 15:5+3+4x6

Keith wrote the expression shown to determine the cost in dollars.bor an upcoming(127.50 - 23.50) + 3(86.50 +4)Which expression is equivalent to the one Keith w

In the past month, Amy rented 7 video games and 4 DVDs. The rental price for each video game was $3.30. The rental price for each DVD was $4.20. What is the tot

Isolationists were people who believed that Europe's war should not be a concern of the United States. Please select the best answer from the choices provided T

Are scientific theories all proven facts?

A word that is an action or a state of being is known as a(n) __ O A. verb O O B. preposition c. adverb O D. noun

The Fifteenth Amendment was ratified in order to — *