tisonm23
tisonm23 tisonm23
  • 01-03-2021
  • Mathematics
contestada

find the scale factor.

find the scale factor class=

Respuesta :

Hrishii
Hrishii Hrishii
  • 01-03-2021

Answer:

2/9

Step-by-step explanation:

Scale factor = 10/45 = 2/9

Answer Link

Otras preguntas

A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?
What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis
how much longer is a 1-inch button than a 3/8-inch button?how much longer is a 1-inch button then a 3/8
BC is parallel to DE What is AC? Enter your answer in the box.
why are the hindlimbs important on the frog
Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa
Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the area of a kite with diagonals 10 & 5
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36