321elparaiso 321elparaiso
  • 04-03-2021
  • History
contestada

what called a stop to the european colonization of the americas

Respuesta :

curiouschild
curiouschild curiouschild
  • 10-03-2021

Answer:Although Europeans had explored and colonized northeastern North America c. 1000 CE, European colonization of the Americas typically refers to the events that took place in the Americas between about 1500 CE and 1800 CE, during the Age of Exploration.

Explanation:

Answer Link

Otras preguntas

Explain who or what "Año Viejo" is and its significance.
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
why is it critical to your cells to be near capillaries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Please answer theses division problems!! 9 divided by 3/7