wrms2007 wrms2007
  • 04-03-2021
  • Social Studies
contestada

What is a biological commodity

Respuesta :

emcampbell17
emcampbell17 emcampbell17
  • 04-03-2021

Answer:

n the use of living organisms or their toxic products to induce death or incapacity in humans and animals and damage to plant crops, etc

Explanation:

Answer Link

Otras preguntas

Determine the total time that must elapse until only 1/16 of an original sample of th-234 remains unchanged.
14. Find the coordinates of the circumcenter for ∆DEF with coordinates D(1,3) E (8,3) and F(1,-5). Show your work.
On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
If the area of a square is 32 ft2, how long is its diagonal?
CAN SOMEONNE HELP ME PLEASE !!!
If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?
Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.
Use the excerpt to answer the question. We hold these truths to be self-evident: that all men and women are created equal; that they are endowed by their Creato
In a class of 7, there are 3 students who have done their homework. If the teacher chooses 3 students, what is the probability that none of the three students h