linellebea
linellebea linellebea
  • 01-05-2021
  • Mathematics
contestada

What is the image point of (5,-4)(5,−4) after a translation left 4 units and down 3 units?

Respuesta :

amuratov
amuratov amuratov
  • 01-05-2021

Answer:

(1,-7)

Step-by-step explanation:

1) (5,-4). 4 units to the left will be (1,-4)

2) (1,-4). 3 units down will be (1,-7)

Answer Link
Lulusbarbeq
Lulusbarbeq Lulusbarbeq
  • 01-05-2021
(1,-7)
Is the answer
X is left/ right.
Y is up/down.

5-4 (going left decreases the x) = 1
-4-3 (going down decreases the y) = -7
Remember that two negatives when adding/subtracting stays negative.
Answer Link

Otras preguntas

What advice would you give someone whose life dream is to become a judge?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
I need help on exterior angles!
When you prepare to make a left turn from a one-way road into a two-way road, you must:?
If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?
How did the triple alliance and the triple entente change during the war?
What is the value of x?
What is the slope of the line that contains the points (10,-3) and (8,-9)?
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
With the two endpoints of a diamter how many right triangles can be formed