w6qwhgprt7 w6qwhgprt7
  • 05-05-2021
  • Advanced Placement (AP)
contestada

25. Which of these is one of the longest-lived deep-water submarines?
-Jason
-Alvin
-ROVs
-Trieste

Respuesta :

eugeneappiah007
eugeneappiah007 eugeneappiah007
  • 05-05-2021

Answer:

Trieste

it is a swiss designed

Answer Link

Otras preguntas

Please help ASAP!!!!!!!!!!!!!
What is the lowest level of measurement that a median can be computed?
The montreal school of scholars have drawn together a still-growing framework about the ways in which communication constitutes organization.
Which of the following is a run-on sentence?
please help if you know, thanks!
What is the domain of the this function?
What allows small vertical movements to grow until they produce turbulent airflow?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed
when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar